• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The invention relates to the detection of a biologically associated biomarker of pneumoconiosis in coal workers. Further, the present invention discloses a coalworker pneumoconiosis biomarker and its application, and in particular, an application of an article for detecting an expression level of a biomarker in the preparation of a reagent for indicating the coalworker pneumoconiosis in an object, the biomarker being miR-138 and the reagent being used in a method comprising the steps of: detecting a level of expression of miR-138 in the object, comparing the level of expression of miR-138 in the object at a reference level of expression of miR-138, and indicate the pneumoconiosis of coal workers in the object based on the comparison, the level of expression of miR-138 in the object being below the reference expression level of miR-138 to indicate pneumoconiosis of coal workers in the object. The present invention has identified the link between coalworker pneumoconiosis and the reduced expression level of miR-138, can be used as a specific biomarker for coalworker pneumoconiosis, and therefore has important clinical significance.
    公开号:BE1027147B1
    申请号:E20205042
    申请日:2020-01-22
    公开日:2021-07-02
    发明作者:Hongmei Li；Xiaoming De；Haiming Xu；Jianying Tian；Zhihong Liu；Huifang Yang；Xinchen Shi
    申请人:Univ Ningxia Medical；
    IPC主号:
    专利说明:

    BIOMARKER OF WORKERS 'PNEUMOCONIOSIS
    CHARBONIERS AND ITS APPLICATION Technical Field of the Invention The invention relates to the detection of a biologically associated biomarker of pneumoconiosis in coal workers. Further, the present invention discloses a coalworker pneumoconiosis biomarker and its application, and has identified the link between coalworker pneumoconiosis and the reduced expression level of miR-138. The biomarker can also be used for the following purposes. STATE OF THE PRIOR ART The pneumoconiosis of coal workers (also called Coal Workers' Pneumoconiosis, CWP in English) is the type of respiratory disease most common in occupational diseases, it is a systemic disease caused by the long-term innalation of Productive powders (dusts) during professional activities and by their retention in the lungs and based on diffuse fibrosis of lung tissue (“Diagnostic criteria for pneumoconiosis” (GBZ70-2009)). The pneumoconiosis of coal workers is at the heart and difficulty of the prevention and treatment of occupational diseases in China. Historically, the diagnosis of anthrax's pneumoconiosis has been primarily made by learning about the medical history of labor in conjunction with imaging. Once diagnosed, the patient's pulmonary fibrosis process cannot be reversed. The main reason for this is that research on the pathogenesis of pneumoconiosis in coal workers is unclear. Regarding the pathogenesis of pneumoconiosis of coal workers, researchers have proposed various theories, such as the theory of mechanical stimulation, the theory of chemical poisoning, the theory of polymerization of silicic acid, the theory of activity. surface and the theory of immunology, etc. In recent years, the theory of global effects is becoming a trend. The theory holds that when dusts enter the lungs, they induce alveolar defense responses and macrophages engulf the dusts and become dust cells, and that the toxic effects of dusts gradually lead to the death of dust cells (l apoptosis, autophagy and necrosis being involved). The released dust is engulfed by new macrophages and the above process is repeated, eventually causing lung tissue damage, destruction and repair. When dust cells die, fibrogenic factors and lipoproteins are released. Fibrogenic factors stimulate fibroblasts to produce large amounts of collagen fibers. As antigens, lipoproteins stimulate immune cells to produce corresponding antibodies. Antigens and antibodies react to form an immune complex, which deposits on the reticular tissue made up of collagen fibers, undergoes a glass-like change, and gradually forms nodules.
    In recent years, domestic researchers have carried out a lot of related research, According to in-depth analysis, the research includes the following aspects.
    First, it has been explored that new means of detection are used for the clinical diagnosis of pneumoconiosis of coal workers, such as high resolution computed tomography (CT), CT quantification by dual energy spectrometry, etc. Second, the pathogenesis of pneumoconiosis in coal workers was explored.
    Researchers' exploration of the pathogenesis of coalworker pneumoconiosis covers a wide range of levels, including including the level of nucleic acid (microRNA, microRNA gene polymorphisms, unique nucleotide polymorphisms in genetic pathway tags. apoptotic signal of FAS, etc.), the level of proteins (membrane ion channels of macrophages, cytokines of connective tissue, transforming growth factors B, inflammatory factors, tumor necrosis factors, apolipoproteins APoA-1, etc.), the level receptor ligand and signaling pathway (TAM receptor tyrosine / specific growth arrest gene product 6 (TAM / Gas6), PI3K mediated cellular autophagy, endogenous lysophosphatidic acid and its receptor, etc.), and the level cellular (dendritic cells, circulating fibroblasts (characteristics of stem cells), mesenchymal stem cell transplant from the marrow bone, immune system components - Breg, Tregs and Th17, etc.). Third, the methods of prevention, prediction and treatment of pneumoconiosis of coal workers were discussed.
    One of the most effective prevention methods is to control the concentration of dust in the workplace.
    Building a neural network model is one of the common methods for predicting pneumoconiosis in coal workers.
    For example, Liu Hongbo et al. constructed a Bayesian standardized neural network model based on the dust exposure characteristics of miners in a coal mining industry group exposed to dust to predict the risk of dust-exposed miners being attacked by worker pneumoconiosis coal workers in the future, and then to control and reasonably and effectively treat pneumoconiosis in coal workers.
    Research to explore treatment methods mainly includes short peptides (Ac-SDKP), blocking signaling pathways (Wnt / B-catenin) and drugs (Qidan granules). Fourth, some researchers have paid attention to another special type of coalworker pneumoconiosis, desert coalworker pneumoconiosis.
    Under the current level of knowledge, discovering effective methods for the early diagnosis of pneumoconiosis in coal workers represents a difficult direction of research.
    The results of the literature review show that most of the existing related studies focus on the abnormal expression of single-level biomarkers (such as inflammatory cytokines and antioxidant enzymes and lipid peroxides) in patients with pneumoconiosis. of coal workers.
    For example, research by Yang Wen et al. Found that serum antibodies to interleukin-18 (IL-18) and tumor-like factors (RF) in patients with coalworker pneumoconiosis were highly expressed and increased in expression terms with increasing stages of expression of x-ray chest radiographs within a certain range.
    But there is no correlation between the two, suggesting that IL-18 antibodies and RF may participate in the onset and development of coalworker pneumoconiosis through different mechanisms of action.
    Studies by Cui et al. showed that higher levels of Hsp70 and lower levels of Hsp27 in plasma may be associated with an increased risk of chronic obstructive pulmonary disease in the population of coal workers.
    It should be emphasized that these markers are not indicators of the damage specific to coalworker pneumoconiosis, and that no biomarkers have actually been used in the early clinical diagnosis of coalworker pneumoconiosis.
    Disclosure of the invention
    An object of the present invention is to solve at least the above problems and to provide at least the advantages described below.
    Another object of the present invention is to provide a coalworker pneumoconiosis biomarker and its application, and the present invention has identified the link between coalworker pneumoconiosis and the reduced expression level of miR-138. The biomarker can also be used for the following purposes, for example, detecting an expression level of a biomarker in a sample and comparing it with a reference expression level to obtain a comparison result, and indicate or then assess the phase of workers' pneumoconiosis
    … Charcoal makers depending on the result of the comparison.
    To achieve these objects and other advantages according to the invention, an application of an article for detecting an expression level of a biomarker in the preparation of a reagent for indicating the pneumoconiosis of coal workers in an object is proposed, the biomarker being a miR-138, and the reagent being used in a method comprising the following steps of:
    - detect a level of expression of miR-138 in the object,
    - Compare the level of expression of miR-138 in the object with a reference level of expression of miR-138, and - indicate the pneumoconiosis of coal workers in the object on the basis of the comparison, 5 the level expression of miR-138 in the object being lower than the reference level of miR-138 expression to indicate pneumoconiosis of coal workers in the object.
    Preferably, the level of expression of the biomarker is detected in a detection sample obtained from the object.
    Preferably, the detection sample is of human origin, the detection sample being mononuclear cells from the peripheral venous blood of the object. Preferably, when the expression level of MiR-138 in the object is less than 26% or more of the reference level of miR-138 expression, this indicates that the object has coalworker pneumoconiosis. , more specifically, when the level of expression of miR-138 in the object is less than 26% to 44% or more of the reference level of expression of miR-138, this indicates that the object has phase | coalworker pneumoconiosis, and when the expression level of miR-138 in the object is less than 68% or more of the reference level of miR-138 expression, this indicates that the object has the phase | pneumoconiosis of coal workers. Preferably, the pneumoconiosis of coal workers comprises the phase | of pneumoconiosis in coal workers and the phase | pneumoconiosis of coal workers.
    Preferably, the article for detecting the level of expression of the biomarker is further used to detect the level of expression of a gene encoding miR-138. Preferably, the expression level of the gene encoding miR-138 in the object is lower than the reference level of expression of the gene encoding miR-138 to indicate pneumoconiosis of coal workers in the object.
    The present invention includes at least the following beneficial effects.
    In the present invention, the level of miR-138 expression in peripheral venous blood mononuclear cells of patients with phase | of coalworker pneumoconiosis and phase II of coalworker pneumoconiosis shows a progressive decreasing trend, and with worsening of the condition of coalworker pneumoconiosis patients, the level of miR expression -138 shows a significant trend of gradual decrease. Therefore, according to the present invention, the detection result of the expression level of miR-138 in the detection sample can provide a more reliable and sensitive database for the early auxiliary diagnosis of coal workers pneumoconiosis, and can help medical personnel better diagnose whether a patient has coalworker pneumoconiosis and assess the grade of coalworker pneumoconiosis.
    Other advantages, objects and characteristics of the present invention will be partially realized by the following description, and a part of them will be understood by those skilled in the art by the research and practice of the present invention.
    Detailed Disclosure of Embodiments of the Invention The present invention will be described in more detail with reference to the following embodiments, so that those skilled in the art can practice the present invention with reference to the description text.
    It should be understood that terms such as "have", "include" and "include" as used herein do not exclude the presence or addition of one or more other elements or combinations thereof. The present invention provides an application of an article for detecting an expression level of a biomarker in the preparation of a reagent for indicating pneumoconiosis of coal workers in an object, the biomarker being a miR-138, and the reagent. being used in a method comprising the following steps of:
    - detect a level of expression of miR-138 in the object, - Compare the level of expression of miR-138 in the object with a reference level of expression of miR-138, and - indicate the pneumoconiosis of coal workers in the object based on the comparison with the expression level of miR-138 in the object being lower than the reference level of miR-138 expression to indicate pneumoconiosis of coal workers in the object .
    In a preferred embodiment, the level of expression of the biomarker is detected in a detection sample obtained from the object.
    In a preferred embodiment, the detection sample is of human origin, the detection sample being mononuclear cells from the peripheral venous blood of the object.
    In a preferred embodiment, when the expression level of miR-138 in the object is less than 26% or more of the reference level of miR-138 expression, this indicates that the object has pneumoconiosis of coal workers.
    In a preferred embodiment, the pneumoconiosis of coal workers comprises the phase | coalworker pneumoconiosis and phase II coalworker pneumoconiosis, and when the expression level of miR-138 in the object is less than 26% to 44% or more of the reference expression level of miR-138, this indicates that the object has reached phase | coalworker pneumoconiosis, and when the expression level of miR-138 in the object is less than 68% or more of the reference level of miR-138 expression, this indicates that the object has phase II of pneumoconiosis of coal workers.
    In a preferred embodiment, the article for detecting the level of expression of the biomarker is further used to detect the level of expression of a gene encoding miR-138.
    In a preferred embodiment, the level of expression of the gene encoding miR-138 in the object is lower than the reference level of expression of the gene encoding miR-138 to indicate pneumoconiosis of coal workers in the object. 'object.
    In the following, the present inventors will perform the sampling and detection of patients diagnosed with pneumoconiosis of coal workers as an experimental group and workers in the dust exposure environment as a reference group, respectively, in order to verify that the variations in the expression levels of miR-138 in the peripheral venous blood mononuclear cells of the objects detected are indeed as described in the present invention. The objects of the study were from patients with pneumoconiosis of coal workers and a crowd of coal mine physical examination of an occupational disease hospital in Ningxia from October 2016 to December.
    2016. The case group is a crowd of the coal workers pneumoconiosis group, and the dust exposure group is a crowd engaged in operations related to dust exposure in coal mines. The inclusion and exclusion criteria for the pneumoconiosis group of coal workers are as follows: 1. The work history is clear; 2. According to China's "Occupational Pneumoconiosis Diagnosis" (GBZ70-2015), the diagnosis is made by a Coal Worker Pneumoconiosis Diagnosis Expert Group made up of medical institutions with disease diagnosis skills. professional ; 3. All objects are men; 4. The subjects of the study did not suffer from other major pulmonary diseases other than the pneumoconiosis of coal workers;
    5. All objects are informed and willing to cooperate with the investigation. The inclusion and exclusion criteria for the dust exposure group are as follows: 1. The objects of the study are engaged in operations related to dust exposure in coal mines and are not diagnosed as pneumoconiosis in coal workers by the institution for the medical diagnosis of occupational diseases; 2. All objects are men; 3. The objects of study do not have major lung diseases; 4. The objects of study are informed and cooperated.
    The "Epidemiology and Pneumoconiosis Questionnaire for Coal Mines in Ningxia" was designed to investigate information such as names, sex, dates of birth, work experience, and start and end time. , daily working hours, chronic respiratory symptoms, medical history, existing illness, exposure to dust or not, and duration of dust exposure for the coal workers pneumoconiosis group and the exposure group to _ dust.
    By chronic respiratory symptoms are meant symptoms such as sputum and pharyngitis. l.
    Sample collection 5 ml of EDTA anticoagulated peripheral venous blood was obtained early in the morning on an empty stomach, and Lymphocyte Separation Solution (Corning, USA) was used to isolate monocytes (PBMC). Pure RNAprep Micro Kit (Tiangen Biotech (Beijing) Co., Ltd.) was used to extract total RNA from PBMCs.
    The cDNA was obtained by reverse transcription using the TIANscript RT Kit (Tiangen). The real-time PCR quantification method was used to detect the expression of miR-138 in PBMCs (miRcute Plus miRNA qPCR detection kit (SYBR Green), Tiangen). All operations were carried out by specific persons in strict accordance with the procedures provided by the kits.
    He.
    Detection of expression of miR-138 in PBMCs using the fluorescent quantification method of PCR The qRT-PCR detection kit was used to detect expression of miR-138, and the internal reference gene was U6 ( table 1). Table 1 Expression of miR-138 in Peripheral Blood Mononuclear Cells of Study Objects
    Gene Forward primer (5'-3 ') Reverse primer (5'-3 ”) miR-138 GGTGTCGTGGAGTCGGCAA AACTTCACAACACCAGCTTA U6 CGGGTTTGTTTTGCATTTCT _AGTCCCAGCATGAACAGCTT Reaction conditions were as follows: 95 ° C for 10 seconds, 60 ° C ° C for 30 seconds, 72 ° C for 30 seconds and 40 cycles.
    The reaction system was 20 HL: 1 UL of cDNA product, 8 HL of ddHzO, 10 UL of 2xmiRcute Plus miRNA Premix, 0.5 HL of forward primer (polynucleotide sequence shown in SEQ ID NO.1), and 0 , 5 µL reverse primer.
    The relative expression of miR-138 was calculated according to the 2AACT method. Statistical analysis The statistical analysis was carried out by the SPSS 22.0 software. Normally distributed data were described using means + standard deviation (Xts), comparison between groups was performed using single-factor analysis of variance method, and pairwise comparison within groups a was performed using the LSD method.
    The 2 x 2 factor design data uses the factor design analysis of variance.
    Normally undistributed data is described using medians + quartile intervals (M + Q). The comparison between two groups was performed using the Mann-Whitney U detection method.
    The comparison between several groups was carried out using the Kruskal-Wallis H.
    The data count rates were compared using the Pearson x 2 detection method. Risk factors for pneumoconiosis of coal workers were analyzed by logistic regression method (inverse method, Ain = 0.10, Qout = 0.15). Research Results Expression of MiR-138 in Peripheral Blood Mononuclear Cells of Coal Worker Pneumoconiosis Patients The results of single-factor analysis of variance showed that the expression levels of miR-138 in the cells Peripheral blood mononuclear cells of coalworker pneumoconiosis patients were significantly downregulated compared to the dust exposure group.
    Multiple comparison results showed that there were significant differences between the dust exposure group, phase | of pneumoconiosis in coal workers and the phase | pneumoconiosis of coal workers.
    If the expression levels of miR-138 are classified in descending order, they correspond respectively to the dust exposure group> phase | coalworker pneumoconiosis> phase II coalworker pneumoconiosis (as shown in Table 2). The expression levels of miR-138 in peripheral blood mononuclear cells of patients with coalworker pneumoconiosis showed a good correlation with the stages of onset and development of coalworker pneumoconiosis course.
    This result suggests that the expression levels of miR-138 in peripheral blood mononuclear cells of patients with coalworker pneumoconiosis can be used as a biomarker for the early auxiliary diagnosis of coalworker pneumoconiosis.
    Table 2 Comparison of the expression levels of miR-138 (X * S) Group Number of cases miR-138 Group of exposure to 69 1.00 + 0.142 pPOuss 1st Phase I of 0.65 + 0.09t pneumoconiosis of 43 charcoal workers Phase II of the 0.28 + 0.04 ° pneumoconiosis of workers 24 charcoal makers F-value 40.967 P-value 0.000 appendix Basic crowd information
    A total of 69 patients with pneumoconiosis of coal workers and 67 workers in the dust exposure group were studied in this study.
    The M + Q age of the crowd in the pneumoconiosis group of coal workers was 48 + 7 years, and the M + Q age of the crowd in the dust exposure group was 43 + 12 years.
    The working age and duration of dust exposure of the pneumoconiosis group of coal workers were 26.0 + 7.0 years and 22.0 + 8.0 years, respectively.
    The working age and duration of dust exposure of the dust exposure group were 22.0 + 8.0 years and 19.0 + 17.0 years, respectively.
    There was no difference in the median daily working hours between the dust exposure group and the pneumoconiosis group of coal workers (as shown in Table 3 below). Table 3 Comparison of measurement data between dust exposure group and pneumoconiosis of coal workers (M + Q) Group! Age (years) Age at work N at work (years) X daily dust (h) (years) Exposure group to 69 43.0 + 12.0 22.0 + 16.5 19.0 + 17.0 8.0 + 0., 4 dusts PREUMOCOMIOSIS group 67 48.047 .0 = 260 + 70 = 22.0 + 80 8.0 + 2.0 of coal workers The level of education of the study objects of the dust exposure group and the group of coal burners pneumoconiosis was mainly distributed in college.
    Specifically, the proportion of diplomas in the dust exposure group is college and below, high school and university and above, accounting for 50.72%, 27.54% and 21.74% respectively , and the proportion of graduates in the coal workers pneumoconiosis group is college and below, high school and university and above, accounting for 88.06%, 8.96% and 2.99% respectively . Statistical analysis data for chronic respiratory symptoms diagnosis rates and medical history are shown in Table 4 below.
    Table 4 Comparison of count data between the dust exposure group and the pneumoconiosis group of coal workers Symptoms Antecedents Education level respiratory in, chronic medical Group N è P college, University Number Rate of Number Rate of and at - High school ‚,; . ,. ; ; d é et au- diagonos diagnosti diagonos diagni Essou £ 7 7 s above é c é c Exposure group 69 35 19 15 55 79.71 18 26.09 Group of pneumoconios e 67 59 6 2 65 97.01 8 11.94 coal workers Good Although the embodiments of the present invention have been described as above, they are not limited to the applications listed in the description and embodiments, and they can be applied to various fields suitable for the present invention.
    For those skilled in the art, other modifications can be readily made, so that the present invention is not limited to the specific details and embodiments shown and described herein without departing from the general concepts defined by the description. and an equivalent scope.
    <110> Ningxia Medical University <120> Biomarkers of pneumoconiosis in coal workers and their applications <160> 4
    <210> 1 <211> 19 <212> DNA <213> Artificial sequence
    <220> <400> 1 ggtgtcgtgg agtcggcaa 19
    <210> 2 <211> 17 <212> DNA <213> Artificial sequence
    <220> <400> 2 aacttcacaa caccagctta 20 <210> 3 <211> 20 <212> DNA
    <213> Artificial sequence <220> <400> 3 cgggtttgtt ttgcatttct 20 <210> 4 <211> 21
    <212> DNA <213> Artificial sequence <220> <400> 4 agtcccagca tgaacagctt 21
    权利要求:
    Claims (7)
    [1]
    1. Application of an article for detecting an expression level of a biomarker in the preparation of a reagent for indicating pneumoconiosis of coal workers in an object, the bhiomarker being a miR-138, and the reagent being used in a method comprising the following steps consisting of: - detecting ONE level of expression of miR-138 in the object, - comparing the level of expression of miR-138 in the object with a reference level of expression of miR -138, and - indicate the pneumoconiosis of coal workers in the object based on the comparison, the expression level of miR-138 in the object being lower than the reference level of miR-138 expression to indicate pneumoconiosis of coal workers in the object.
    [2]
    2. Application according to claim 1, characterized in that the level of expression of the biomarker is detected in a detection sample obtained from the object.
    [3]
    3. Use according to claim 1, characterized in that the detection sample is of human origin, the detection sample being mononuclear cells of the peripheral venous blood of the object.
    [4]
    4. Application according to claim 1, characterized in that when the level of expression of miR-138 in the object is less than 26% or more of the reference level of expression of miR-138, this indicates that the object has the pneumoconiosis of coal workers, more precisely, when the level of expression of miR-138 in the object is less than 26% to 44% or more of the reference level of expression of miR-138, this indicates that the object has reached phase | coalworker pneumoconiosis, and when the expression level of miR-138 in the object is less than 68% or more of the reference level of miR-138 expression, this indicates that the object has phase II of pneumoconiosis of coal workers.
    [5]
    5. Use according to claim 1, characterized in that the pneumoconiosis of coal workers comprises the phase | of the pneumoconiosis of coal workers and phase II of the pneumoconiosis of coal workers.
    [6]
    6. Use according to claim 1, characterized in that the article for detecting the level of expression of the biomarker is further used to detect the level of expression of a gene encoding miR-138.
    [7]
    7. Use according to claim 1, characterized in that the level of expression of the gene encoding miR-138 in the object is lower than the reference level of expression of the gene encoding miR-138 to indicate pneumoconiosis. of coal workers in the object.
    类似技术:
    公开号 | 公开日 | 专利标题
    Boertien et al.2019|Increasing comparability and utility of gut microbiome studies in Parkinson’s disease: a systematic review
    Ambatipudi et al.2017|DNA methylome analysis identifies accelerated epigenetic ageing associated with postmenopausal breast cancer susceptibility
    Muller et al.2015|Exosomes isolated from plasma of glioma patients enrolled in a vaccination trial reflect antitumor immune activity and might predict survival
    Grant et al.2017|A longitudinal study of DNA methylation as a potential mediator of age-related diabetes risk
    CN107267510B|2020-06-30|Application of long-chain non-coding lncRNA-OD1 in osteoporosis diseases
    JP2006510382A5|2010-07-01|
    Chu et al.2012|The polymorphisms of IL-4, IL-4R and IL-13 genes and bladder cancer risk in a Chinese population: a case–control study
    CN107419008B|2021-07-13|Method and kit for accurately diagnosing Parkinson&#39;s disease in early stage
    CN105567862B|2018-12-14|CDK18 is preparing the purposes in diagnosis of coronary heart disease product
    WO2017031067A2|2017-02-23|Biomarkers for treatment of alopecia areata
    BE1027147B1|2021-07-02|BIOMARKER OF PNEUMOCONIOSIS OF COAL WORKERS AND ITS APPLICATION
    Singh et al.2018|Novel blood-based transcriptional biomarker panels predict the late-phase asthmatic response
    CN107937514B|2021-05-28|Application of primer in preparation of product for diagnosing pulmonary tuberculosis
    Darriet et al.2018|Fluorescence in situ hybridization microscopic detection of Bacilli Calmette Guérin mycobacteria in aortic lesions: a case report
    CN109837340A|2019-06-04|Peripheral blood gene marker for lung cancer non-invasive diagnosis
    WO2017107545A1|2017-06-29|Scap gene mutant and application thereof
    CN110257498B|2021-01-01|Serum/plasma LncRNA marker combination containing ENST00000505175.1 and application thereof
    US10227651B2|2019-03-12|Gene expression based biomarker system for irritable bowel syndrome | diagnosis
    Kennel et al.2021|Longitudinal profiling of circulating miRNA during cardiac allograft rejection: a proof‐of‐concept study
    Jiang et al.2015|Molecular analysis of inflammatory bowel disease: clinically useful tools for diagnosis, response prediction, and monitoring of targeted therapy
    JP2013188208A|2013-09-26|Data acquisition method for atll diagnosis, kit for diagnosis of atll and atll diagnosis system
    Choudhary et al.2018|Temporal profile of serum levels of IL-6 in acute ischemic stroke and its relationship with stroke severity and outcome in indian population
    CN107447042A|2017-12-08|Molecular marker and its application for diagnostic activities tuberculosis disease
    Omar et al.2019|Leucocytic DNA methylation of interleukin-6 promoter reduction in pre-hypertensive young adults
    Jeon et al.2020|Transcriptomic profiles and their correlations in saliva and gingival tissue biopsy samples from periodontitis and healthy patients
    同族专利:
    公开号 | 公开日
    CN111041087A|2020-04-21|
    BE1027147A1|2020-10-21|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    CN104164500B|2014-08-01|2016-04-20|南京医科大学|The application of miRNA marker hsa-miR-486-5p|
    法律状态:
    2021-08-11| FG| Patent granted|Effective date: 20210702 |
    优先权:
    申请号 | 申请日 | 专利标题
    CN201911258933.XA|CN111041087A|2019-12-10|2019-12-10|Coal dust lung biomarker and application thereof|
    [返回顶部]